cliotide T15 cds(253) Nucleic Acid Card

General Information
Name cliotide T15 cds
Sequence atggcatacgttaggcttacttctcttgctgtggtcttct
Organism Clitoria ternatea L

Nguyen KN, Nguyen GK, Nguyen PQ, Ang KH, Dedon PC, Tam JP (2016) Immunostimulating and Gram-negative-specific Antibacterial Cyclotides from the Butterfly Pea Clitoria ternatea. FEBS J doi:10.1111/febs.13720:0-0

Proteins Encoded cliotide T15
Links GenBank KT732713