Amanita bisporigera phallacidin (PHA1) mRNA, complete cds(96) Nucleic Acid Card

General Information
Name Amanita bisporigera phallacidin (PHA1) mRNA, complete cds
Sequence cccttgacctctgctctaaatcacaatgtctgacatcaat
gccacccgtcttcccgcttggcttgtagattgcccatgcg
tcggtgacgatgtcaaccgtctcctcactcgtggcgagag
cctttgctaaatgtctcatccactagtcaaggcaagttgt
tgacaatgtcaggcttgcggaccgttgagcctgcatcgga
aacgactcacgttctttctcattctttctgattctcattt
gtaaacatataaaacccacgtaaatgatccgttgtgctat
ggaatgcaatatacttgtgaatgtgaaaaaa
Notes
Sequence translation MSDINATRLPAWLVDCPCVGDDVNRLLTRGESLC
Organism Amanita phalloides

References
Hallen HE, Luo H, Scott-Craig JS, Walton JD (2007) Gene family encoding the major toxins of lethal Amanita mushrooms Proc Natl Acad Sci U S A 104:19097-19101

Cross-references
Proteins Encoded phallacidin
phallacidin precursor
Links