Amanita bisporigera alpha-amanitin (AMA1) mRNA, complete cds(95) Nucleic Acid Card

General Information
Name Amanita bisporigera alpha-amanitin (AMA1) mRNA, complete cds
Sequence cctctaaacctcacaatcccaatgtctgacatcaatgcta
cccgtcttcccatctggggtatcggttgcaacccgtgcgt
cggtgacgacgtcactacactcctcactcgtggcgaggcc
ctttgttaaattccccatccatttgtccgctgctatgaca
cgaagtagtgggcgatacaagttgtggacgttatcaggct
tgggccgttgagcctgcatcggaaacaacttatgttcttt
cttttttctgttttcatttgttaaaatacaaaacccatgt
cgatgatctgtgttgtagtcaatataaagttgtactgtgt
ttcaaaa
Notes
Sequence translation MSDINATRLPIWGIGCNPCVGDDVTTLLTRGEALC
Organism Amanita phalloides

References
Hallen HE, Luo H, Scott-Craig JS, Walton JD (2007) Gene family encoding the major toxins of lethal Amanita mushrooms Proc Natl Acad Sci U S A 104:19097-19101

Cross-references
Proteins Encoded alpha-amanitin
alpha-amanitin precursor
cliotide T12
Links