Mra20 mRNA, partial cds(50) Nucleic Acid Card

General Information
Name Mra20 mRNA, partial cds
Sequence AGTTTGCTACAAGAACTCTCTTGCTCTTCCAACCTTGGAA
AAAGATGTGATCACCCCTGAAGCTCTTGAGGCTGTTCTTA
AAAGCAATGGTGGTGCCACTGTTAACATCAAAACTATTGT
CTCAAACACCATCTTCGAGGAGGCACTCCTTAACAATGCC
AACCATGGTCTTGGTGGTACCATTCCCTGCGGTGAAAGCT
GTGTCTTTATTCCATGCCTCACTAGCGCTATTGGGTGCTC
TTGCAAGAGCAAAGTTTGCTACAAGAACTCTCTTGCCCTT
AACTAAGACCCATCAATCTTTACAATAGCTAGCGTGGAGC
ATAATCCGTGTTTACATCCTTGTGACTTCTGAGCTAGATA
GGAAGCTATATATGCTTCTAACATGCTGCGAAATCATGTC
AAGCATGCTTCCTATCTCTCTTTTTAACTAAAATAAAATA
ATGTTCCACGCC
Notes
Sequence translation VCYKNSLALPTLEKDVITPEALEAVLKSNGGATVNIKTIV
SNTIFEEALLNNANHGLGGTIPCGESCVFIPCLTSAIGCS
CKSKVCYKNSLALN
Organism Melicytus ramiflorus

References
Trabi M, Mylne JS, Bharathi R, Sando L and Craik DJ (2009) Circular proteins from Melicytus (Violaceae) refine the conserved protein and gene architecture of cyclotides. Org Biomol Chem 7:2378-2388

Cross-references
Proteins Encoded Mra14b
Mra20 precursor protein (partial)
Links