Hyst A (partial)(39) Nucleic Acid Card

General Information
Name Hyst A (partial)
Sequence TGCGGGGAGACGTGCATCTGGGGGAGGTGCTACTCGGAGA
ACATTGGGTGTCACTGCGGGTTTGGCATATGTACCCTCAA
TTCTCTTGACAATTGA
Notes
Sequence translation CGETCIWGRCYSENIGCHCGFGICTLNSLDN
Organism Hybanthus stellarioides

References
Simonsen SM, Sando L, Ireland DC, Colgrave ML, Bharathi R, Goransson U, Craik DJ (2005) A continent of plant defense peptide diversity: cyclotides in Australian Hybanthus (Violaceae). Plant Cell 17:3176-89

Cross-references
Proteins Encoded Hyst A (partial)
Hyst A precursor (partial)
Links