garvicin ML genomic DNA(113) Nucleic Acid Card

General Information
Name garvicin ML genomic DNA
Sequence ATAAAATAAAGTAATTTATAGGAGGATTATTATGTTTGAT
TTAGTCGCGACTGGAATGGCTGCAGGTGTAGCAAAAACTA
TTGTTAATGCCGTTAGTGCTGGTATGGATATTGCCACTGC
TTTATCATTGTTCTCAGGAGCTTTTACTGCAGCTGGGGGA
ATTATGGCACTCATTAAAAAATATGCTCAAAAGAAATTAT
GGAAACAGCTTATTGCTGCATAACTTCTGGAAAAATCAAT
AAAAAATAAAAGTAACTTATATAAG
Notes
Sequence translation MFDLVATGMAAGVAKTIVNAVSAGMDIATALSLFSGAFTA
AGGIMALIKKYAQKKLWKQLIAA
Organism Lactococcus garvieae

References
Borrero J, Brede DA, Skaugen M, Diep DB, Herranz C, Nes IF, Cintas LM, Hernández PE (2011) Characterization of garvicin ML, a novel circular bacteriocin produced by Lactococcus garvieae DCC43, isolated from mallard ducks (Anas platyrhynchos). Appl Environ Microbiol 77:369-373

Cross-references
Proteins Encoded garvicin ML precursor
Links