Gpc1(103) Nucleic Acid Card

General Information
Name Gpc1
Sequence gctgcattcgctcttcccgcccttgctagctttagcttgg
Organism Gloeospermum pauciflorum Hekking

Burman R, Gruber CW, Rizzardi K, Herrmann A, Craik DJ, Gupta MP, Göransson U (2010) Cyclotide proteins and precursors from the genus Gloeospermum: filling a blank spot in the cyclotide map of Violaceae. Phytochemistry 71:13-20

Proteins Encoded Gpc1 precursor