Gbc3(100) Nucleic Acid Card

General Information
Name Gbc3
Sequence gctgcttttgcacttcccgcccttgcaacctttgaaagag
Notes This sequence was named Gbc4 in the NCBI nucleotide database, but we have adopted the name published in the original article Burman et al 2010.
Organism Gloeospermum blakeanum (Standl.) Hekking

Burman R, Gruber CW, Rizzardi K, Herrmann A, Craik DJ, Gupta MP, Göransson U (2010) Cyclotide proteins and precursors from the genus Gloeospermum: filling a blank spot in the cyclotide map of Violaceae. Phytochemistry 71:13-20

Proteins Encoded Gbc3precursor